Table 1 Sequence of the primers utilized in evaluation of fatty acid biosynthesis in livers of rats with isolated hypercholesterolemia
From: Isolated hypercholesterolemia leads to steatosis in the liver without affecting the pancreas
NCBI Reference Sequence | Symbol | Official full name | Â | Sequence |
|---|---|---|---|---|
NM_139192.2 | SCD1 | Stearoyl-coenzyme A desaturase 1 [delta-9-desaturase] | Fw | tgctctgagctgttttgttga |
Rv | cgaaggcatttccagagg | |||
NM_031841.1 | SCD2 | Stearoyl-coenzyme A desaturase 2 [delta-9-desaturase] | Fw | ggtgtcgatgggagctgt |
Rv | ttgatgtgccagcggtact | |||
NM_053445.2 Transcript variant X1: XM_006231075.2 | FADS1 | Fatty acid desaturase 1 | Fw | gagggcattcatgcacaga |
Rv | aggcagacatggtcacacc | |||
NM_031344.2 Transcript variant X1: XM_008760244.1 | FADS2 | Fatty acid desaturase 2 | Fw | agagaagccgctgctgag |
Rv | tgcttcatttgtggaggtagg | |||
NM_017332.1 | FASN | Fatty acid synthase | Fw | ttcagagctacagaaggtgctaga |
Rv | tctaactggaagtgacggaagg | |||
NM_012583.2 | HPRT1 | Hypoxanthine phosphoribosyltransferase 1 | Fw | gaccggttctgtcatgtcg |
Rv | acctggttcatcatcactaatcac | |||
NM_017101.1 | PPIA | Peptidylprolyl isomerase A [cyclophilin A] | Fw | tctgcactgccaagactgag |
Rv | catgccttctttcaccttcc |